Detailed motif information for mDDB0167552db011

An Online Informatics Resource for Dictyostelium

Search dictyBase:
use * as a wildcard character

Genome Browser

BLAST

dictyMart

Stock Center

Research Tools

Help

Links

Detailed motif information

General information

Motif ID: mDDB0167552db011
Number of genes with the motif: 180

Motif logo

Sequence logos were rendered with the Delila Programs from Schneider Lab.

Nucleotide frequency table

position	0	1	2	3	4	5	6	7
A	0%	0%	0%	20%	0%	40%	0%	0%
C	0%	0%	0%	0%	0%	0%	0%	0%
G	0%	80%	0%	40%	80%	60%	0%	100%
T	100%	20%	100%	40%	20%	0%	100%	0%
consensus	T	G	T	K	G	R	T	G

Matching with known binding sites

1. best match (score: 2.38)
with TRANSFAC motif: AS$TEL_03 - artificial sequence (artificial telomer).
bound by: RAP1

       ACGCGTCATGTTTGGTGTGTGGGTGTGTTTGGGTGTGTGGGTGTGTTGG
                        +++|++++
                        TGTTGGTG
                         T GTA  
                           A

2. best match (score: 2.38)
with TRANSFAC motif: AS$TEL_02 - artificial sequence (artificial telomer).
bound by: RAP1

       ACGCGTCATGTGTGGTGTGTGTGTGTGTGTGGGTGTGTGTGTGTGTGGG
                                  +++|++++
                                  TGTTGGTG
                                   T GTA  
                                     A

3. best match (score: 2.38)
with TRANSFAC motif: AS$TEL_01 - artificial sequence (artificial telomer).
bound by: RAP1

       ACGCGTCATGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGG
                        +++|++++
                        TGTTGGTG
                         T GTA  
                           A

4. best match (score: 2.38)
with TRANSFAC motif: GLI$CONS - consensus of genomic target sequences.
bound by: GLI1

       ACCATCATTGTGGGTGGTCTTYGG
               +++|++++
               TGTTGGTG
                T GTA  
                  A

5. best match (score: 2.38)
with TRANSFAC motif: Y$TEF2_01 - TEF2 (translation elongation factor-1alpha TEF2 gene)
bound by: RAP1

       CGCGGTCTGGGTGTATAAATGTGTGGGTGCAACATGAATGTACGGAGGT
                            +++|++++
                            TGTTGGTG
                             T GTA  
                               A

6. best match (score: 1.85)
with TRANSFAC motif: MESAT$PRP2_02 - PRP2 (proline-rich cell wall protein)
bound by: Alfin1

       CATGTGTGTGTTC
         +++||+++
         TGTTGGTG
          T GTA  
            A

7. best match (score: 1.85)
with TRANSFAC motif: CHICK$AAC_12 - SA-ACT (skeletal alpha-actin)

       CGGCCGTCGCCATATTTGGGTGTCGGGC
                     +|+|++++
                     TGTTGGTG
                      T GTA  
                        A

8. best match (score: 1.73)
with TRANSFAC motif: DROME$FTZ_60

       ACGTTATCCTTATTAGATGTTGATGTCCCACG
                        +++|+|++
                        TGTTGGTG
                         T GTA  
                           A

9. best match (score: 1.60)
with TRANSFAC motif: BOMMO$F_07 - fibroin
bound by: SGF-1

       ACAATGTGTAGATGTTTATTCT
             +++|+|++
             TGTTGGTG
              T GTA  
                A

10. best match (score: 1.56)
with TRANSFAC motif: SARPE$LEC_01 - lectin
bound by: ATBP

       ATTGTTTGTGTACTATATACTCTGATGATGATACCAGTTTCGAAATTTACAATCAATACG
         +++||+++
         TGTTGGTG
          T GTA  
            A

Gene expression of all the genes with the motif

Positional distribution of the motif in the regulatory regions of all relevant genes

Links to genes with the motif

Link to results page	Link to detailed gene info
AP2A1	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00055	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00202	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00285	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00386	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00962	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00999	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01514	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01515	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01988	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00097	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00126	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00246	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00252	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00334	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00426	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00465	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00568	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00818	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00885	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00937	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01233	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01353	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01370	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01426	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01673	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01677	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01975	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00188	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00417	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00738	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00847	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_01308	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
H3a	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00281	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00312	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00546	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00626	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00867	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01097	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01511	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01533	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01582	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01744	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01919	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00219	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00288	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00345	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00387	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00390	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00756	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01114	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01279	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01289	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01301	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01446	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02004	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02135	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02254	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02323	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02360	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02503	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02670	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02738	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02921	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03150	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03240	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03272	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03278	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03346	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00064	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00143	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00388	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00995	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01347	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01380	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01500	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01949	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02031	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02083	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02412	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
SRP72	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
aarA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abcB3	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abcG6	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abnB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
act5	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
arpB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
arsB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
aslN	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
atg8	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
carA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
copA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotC	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotD	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cryS	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
culD	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dcsA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dhkM	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dst4	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
erkA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fdfT	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fhkB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
forC	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fscD	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacHH	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacM	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacO	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacX	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gbfA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216321	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216387	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216393	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0220503	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229334	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229337	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229869	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229929	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229936	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0230010	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0230145	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231199	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231406	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231420	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231588	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231646	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231673	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232155	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232156	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232282	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232929	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232937	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233322	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233505	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233636	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233646	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233653	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233715	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233760	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0234027	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235251	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235286	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235315	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235378	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235395	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237680	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237684	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237733	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237900	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gluA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gnt10	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gpt1	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gxcN	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
limB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
lvsA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
mpi	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
mybN	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
oatA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
orcA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
pex7	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
phdA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
polA3	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
psmD14	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
racC	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rcdBB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpb8	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpl27a	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpl36	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rsc22	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sapA1	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
serB	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sgmA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
shkA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sigG	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
srfA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
tnpo	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
trfA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
triA	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
ube2m	dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region

Query for a group of genes. Learn about how the analysis was done.


Return to Home	Supported by NIH (NIGMS and NHGRI)	Send a Message to the dictyBase Curators