An Online Informatics Resource for Dictyostelium
  Search dictyBase:
use * as a wildcard character
Genome Browser BLAST dictyMart Stock Center Research Tools Help Links Contact Us

Detailed motif information

General information
Motif ID: mDDB0167552db011
Number of genes with the motif: 180
Motif logo

Sequence logos were rendered with the Delila Programs from Schneider Lab.
Nucleotide frequency table
position01234567
A 0% 0% 0% 20% 0% 40% 0% 0%
C 0% 0% 0% 0% 0% 0% 0% 0%
G 0% 80% 0% 40% 80% 60% 0%100%
T100% 20%100% 40% 20% 0%100% 0%
consensusTGTKGRTG

Matching with known binding sites

1. best match (score: 2.38)
with TRANSFAC motif:
AS$TEL_03 - artificial sequence (artificial telomer).
bound by: RAP1
       ACGCGTCATGTTTGGTGTGTGGGTGTGTTTGGGTGTGTGGGTGTGTTGG
                        +++|++++
                        TGTTGGTG
                         T GTA  
                           A    
2. best match (score: 2.38)
with TRANSFAC motif: AS$TEL_02 - artificial sequence (artificial telomer).
bound by: RAP1
       ACGCGTCATGTGTGGTGTGTGTGTGTGTGTGGGTGTGTGTGTGTGTGGG
                                  +++|++++
                                  TGTTGGTG
                                   T GTA  
                                     A    
3. best match (score: 2.38)
with TRANSFAC motif: AS$TEL_01 - artificial sequence (artificial telomer).
bound by: RAP1
       ACGCGTCATGTGTGGTGTGTGGGTGTGTGTGGGTGTGTGGGTGTGTGGG
                        +++|++++
                        TGTTGGTG
                         T GTA  
                           A    
4. best match (score: 2.38)
with TRANSFAC motif: GLI$CONS - consensus of genomic target sequences.
bound by: GLI1
       ACCATCATTGTGGGTGGTCTTYGG
               +++|++++
               TGTTGGTG
                T GTA  
                  A    
5. best match (score: 2.38)
with TRANSFAC motif: Y$TEF2_01 - TEF2 (translation elongation factor-1alpha TEF2 gene)
bound by: RAP1
       CGCGGTCTGGGTGTATAAATGTGTGGGTGCAACATGAATGTACGGAGGT
                            +++|++++
                            TGTTGGTG
                             T GTA  
                               A    
6. best match (score: 1.85)
with TRANSFAC motif: MESAT$PRP2_02 - PRP2 (proline-rich cell wall protein)
bound by: Alfin1
       CATGTGTGTGTTC
         +++||+++
         TGTTGGTG
          T GTA  
            A    
7. best match (score: 1.85)
with TRANSFAC motif: CHICK$AAC_12 - SA-ACT (skeletal alpha-actin)

       CGGCCGTCGCCATATTTGGGTGTCGGGC
                     +|+|++++
                     TGTTGGTG
                      T GTA  
                        A    
8. best match (score: 1.73)
with TRANSFAC motif: DROME$FTZ_60

       ACGTTATCCTTATTAGATGTTGATGTCCCACG
                        +++|+|++
                        TGTTGGTG
                         T GTA  
                           A    
9. best match (score: 1.60)
with TRANSFAC motif: BOMMO$F_07 - fibroin
bound by: SGF-1
       ACAATGTGTAGATGTTTATTCT
             +++|+|++
             TGTTGGTG
              T GTA  
                A    
10. best match (score: 1.56)
with TRANSFAC motif: SARPE$LEC_01 - lectin
bound by: ATBP
       ATTGTTTGTGTACTATATACTCTGATGATGATACCAGTTTCGAAATTTACAATCAATACG
         +++||+++
         TGTTGGTG
          T GTA  
            A    
Gene expression of all the genes with the motif

Positional distribution of the motif in the regulatory regions of all relevant genes

Links to genes with the motif
Link to results pageLink to detailed gene info
AP2A1 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00055 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00202 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00285 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00386 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00962 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_00999 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01514 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01515 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC4V2_0_01988 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00097 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00126 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00246 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00252 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00334 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00426 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00465 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00568 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00818 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00885 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_00937 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01233 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01353 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01370 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01426 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01673 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01677 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BC5V2_0_01975 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00188 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00417 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00738 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_00847 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
BEC6V2_0_01308 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
H3a dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00281 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00312 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00546 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00626 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_00867 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01097 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01511 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01533 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01582 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01744 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC1V2_0_01919 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00219 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00288 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00345 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00387 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00390 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_00756 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01114 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01279 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01289 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01301 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_01446 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02004 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02135 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02254 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02323 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02360 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02503 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02670 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02738 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_02921 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03150 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03240 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03272 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03278 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC2V2_0_03346 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00064 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00143 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00388 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_00995 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01347 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01380 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01500 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_01949 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02031 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02083 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
JC3V2_0_02412 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
SRP72 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
aarA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abcB3 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abcG6 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
abnB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
act5 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
arpB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
arsB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
aslN dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
atg8 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
carA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
copA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotC dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cotD dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
cryS dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
culD dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dcsA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dhkM dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
dst4 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
erkA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fdfT dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fhkB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
forC dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
fscD dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacHH dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacM dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacO dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gacX dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gbfA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216321 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216387 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0216393 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0220503 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229334 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229337 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229869 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229929 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0229936 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0230010 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0230145 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231199 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231406 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231420 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231588 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231646 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0231673 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232155 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232156 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232282 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232929 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0232937 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233322 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233505 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233636 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233646 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233653 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233715 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0233760 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0234027 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235251 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235286 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235315 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235378 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0235395 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237680 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237684 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237733 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
geneDDB0237900 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gluA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gnt10 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gpt1 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
gxcN dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
limB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
lvsA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
mpi dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
mybN dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
oatA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
orcA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
pex7 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
phdA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
polA3 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
psmD14 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
racC dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rcdBB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpb8 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpl27a dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rpl36 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
rsc22 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sapA1 dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
serB dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sgmA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
shkA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
sigG dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
srfA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
tnpo dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
trfA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
triA dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
ube2m dictyBase Home >> Chromosome 2:2986637..2991791 >> Gene: AP2A1 >> Regulatory Region
Query for a group of genes. Learn about how the analysis was done.