An Online Informatics Resource for Dictyostelium
  Search dictyBase:
use * as a wildcard character
Genome Browser BLAST dictyMart Stock Center Research Tools Help Links Contact Us

Detailed motif information

General information
Motif ID: mDDB0187808db003
Number of genes with the motif: 43
Motif logo

Sequence logos were rendered with the Delila Programs from Schneider Lab.
Nucleotide frequency table
position01234567
A 0% 40%100% 0% 0% 0% 20% 0%
C 60% 60% 0% 80% 80%100% 80% 0%
G 40% 0% 0% 0% 0% 0% 0% 0%
T 0% 0% 0% 20% 20% 0% 0%100%
consensusSMACCCCT

Matching with known binding sites

1. best match (score: 2.61)
with TRANSFAC motif:
AD2$ADML_01 - adenovirus major late promoter
bound by: TBP
       CCCACCCCTTTTATAGCCCCCCTT
        ++++++++
        CCACCCCT
        GA TT A 
                
2. best match (score: 2.61)
with TRANSFAC motif: HS$EPO_06 - Epo (erythropoietin)

       CCCCCTCCACCCCTCGTTT
             ++++++++
             CCACCCCT
             GA TT A 
                     
3. best match (score: 2.61)
with TRANSFAC motif: MOUSE$THY1_05 - Thy-1 antigen

       CCACCCCTG
       ++++++++
       CCACCCCT
       GA TT A 
               
4. best match (score: 2.61)
with TRANSFAC motif: HS$GPC_05 - GPC (glycophorin C)

       TTTCCACCCCT
          ++++++++
          CCACCCCT
          GA TT A 
                  
5. best match (score: 2.61)
with TRANSFAC motif: DIDI$CP2_01 - CP2 (pst-cathepsin)
bound by: GBF
       AAACCCACCCCTAACTTAACACACCCGCT
           ++++++++
           CCACCCCT
           GA TT A 
                   
6. best match (score: 2.61)
with TRANSFAC motif: BPV1$BPV1_21 - BPV-1 (bovine papilloma virus-1)
bound by: E2, Sp1
       CTCCACCCCTCCTGGTAA
         ++++++++
         CCACCCCT
         GA TT A 
                 
7. best match (score: 2.55)
with TRANSFAC motif: DROME$VVL_01
bound by: Cf1a
       TCGCTAATGATATGCACCCCT
                    |+++++++
                    CCACCCCT
                    GA TT A 
                            
8. best match (score: 2.55)
with TRANSFAC motif: QUAIL$PAX6_09 - Pax-6/Pax-QNR (paired box gene 6)
bound by: Pax-6 (Pax-QNR)
       ATATTAAGGGAAAGTTAGTGCAAAGGCAGCACCCCTCTTTTATTGTCATTGACATTTAAA
                                   |+++++++
                                   CCACCCCT
                                   GA TT A 
                                           
9. best match (score: 2.55)
with TRANSFAC motif: RABBIT$UG_16 - Ug (uteroglobin)
bound by: Sp1, Sp3, Sp3
       GCACCCCTTGCCACACCCCTG
       |+++++++
       CCACCCCT
       GA TT A 
               
10. best match (score: 2.26)
with TRANSFAC motif: HT1$HTLV1_25 - HTLV-I (human T-cell lymphotropic virus type I)
bound by: HEB1-p67, HEB1-p94, Sp1, Tax
       CAGGCGTTGACGACAACCCCT
                    +|++++++
                    CCACCCCT
                    GA TT A 
                            
Gene expression of all the genes with the motif

Positional distribution of the motif in the regulatory regions of all relevant genes

Links to genes with the motif
Link to results pageLink to detailed gene info
AAC4 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC4V2_0_01072 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC4V2_0_01387 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC4V2_0_01939 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC4V2_0_01988 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC4V2_0_02037 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BC5V2_0_01551 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
BEC6V2_0_01323 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
DG1022 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC1V2_0_00872 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC1V2_0_01037 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC2V2_0_01672 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC2V2_0_02325 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC2V2_0_02505 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC2V2_0_03150 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC3V2_0_01399 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC3V2_0_02127 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
JC3V2_0_02284 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
alfA dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
atg9 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
cbpA dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
cprB dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
darA dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
dscA dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
eIF6 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
esd dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0229926 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0231388 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0231652 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0233476 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0233711 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0233835 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0234069 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0234094 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0235286 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0237681 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0237834 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
geneDDB0237865 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
mobA dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
pikF dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
pks29 dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
rasC dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
rcdM dictyBase Home >> Chromosome 1:201006..202483 >> Gene: AAC4 >> Regulatory Region
Query for a group of genes. Learn about how the analysis was done.