An Online Informatics Resource for Dictyostelium
  Search dictyBase:
use * as a wildcard character
Genome Browser BLAST dictyMart Stock Center Research Tools Help Links Contact Us

Detailed motif information

General information
Motif ID: mDDB0188033db023
Number of genes with the motif: 62
Motif logo

Sequence logos were rendered with the Delila Programs from Schneider Lab.
Nucleotide frequency table
position01234567
A 9% 48% 28% 9% 9% 9% 68% 28%
C 61% 2% 2% 2% 22% 2% 22% 61%
G 2% 2% 61% 81% 22% 81% 2% 2%
T 28% 48% 9% 9% 48% 9% 9% 9%
consensusYWRGTGAM

Matching with known binding sites

1. best match (score: 2.18)
with TRANSFAC motif: AS$AGL3_36 - artificial sequence.
bound by: AGL3
       GTGACTGGGGCCCAAATATAGCATGTTCTG
           ++++|+|+
           CTGGTGAC
           TAA G CA
               C
2. best match (score: 2.13)
with TRANSFAC motif: HS$GADD45_01 - GADD45
bound by: p53
       TGGTACAGAACATGTCTAAGCATGCTGGGGACTG
                               ++++|+++
                               CTGGTGAC
                               TAA G CA
                                   C
3. best match (score: 2.12)
with TRANSFAC motif: AS$ZAP1_13 - artificial sequence.
bound by: ZAP1
       GGATCCAGGCGACCAGGCTCGGTCAACGAT
            ++++|+++
            CTGGTGAC
            TAA G CA
                C
4. best match (score: 2.01)
with TRANSFAC motif: AS$RXR_05 - artificial sequence.
bound by: COUP-TF2, RAR-alpha1, RXR-alpha
       GAAGTTTGACCTCCTGGTGACCTCATAGACTAG
                    ++++++++
                    CTGGTGAC
                    TAA G CA
                        C
5. best match (score: 2.01)
with TRANSFAC motif: AS$MEIS1_07 - artificial sequence.
bound by: Meis-1a, Meis-1b
       TGACAGGTGACA
          ++++++++
          CTGGTGAC
          TAA G CA
              C
6. best match (score: 2.01)
with TRANSFAC motif: RAT$EAI_06 - ELA1 (elastase I)

       ACAGGTGACA
        ++++++++
        CTGGTGAC
        TAA G CA
            C
7. best match (score: 2.01)
with TRANSFAC motif: RAT$EAI_05 - ELA1 (elastase I)
bound by: PTF1-beta, XPF-1
       AAGGCAGGGAAAAGCACAGGTGACATG
                       ++++++++
                       CTGGTGAC
                       TAA G CA
                           C
8. best match (score: 1.77)
with TRANSFAC motif: XENLA$VITB1_03 - VIT-B1 (vitellogenin B1)
bound by: BAP, NF-1, NF-1, USF1
       GAAAGATCTGGCGCATGTGCACACAGAAGTG
              ++++|+||
              CTGGTGAC
              TAA G CA
                  C
9. best match (score: 1.73)
with TRANSFAC motif: Y$DDR2_01 - DDR2 (DNA damage responsive)

       GAAAAGACAAAAATGGAAACAGGGGAAAAGAA
                          ++++|++|
                          CTGGTGAC
                          TAA G CA
                              C
10. best match (score: 1.72)
with TRANSFAC motif: RAT$GSTP_02 - GST-P (glutathione transferase P)

       TTTTCTGGCTGCTCCTGGCGAAGG
                     ++++|++|
                     CTGGTGAC
                     TAA G CA
                         C
Gene expression of all the genes with the motif

Positional distribution of the motif in the regulatory regions of all relevant genes

Links to genes with the motif
Link to results pageLink to detailed gene info
BC4V2_0_00680 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC4V2_0_00967 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC4V2_0_01091 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC4V2_0_01098 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC4V2_0_01786 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC5V2_0_00765 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC5V2_0_01033 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BC5V2_0_01517 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_00168 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_00279 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_00694 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_00787 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_00971 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
BEC6V2_0_01296 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
CYP519D1 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
CYP520B1 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
EFTUD1 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC1V2_0_00740 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC1V2_0_00748 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_00379 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_00434 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_00741 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_00764 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_01390 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_01446 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_01657 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_02135 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_02369 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_02670 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC2V2_0_02700 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_00029 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_00455 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_00598 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_00599 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_01172 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_01275 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_01905 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_02013 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
JC3V2_0_02359 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
ancA dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
cnrO dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
ctsD dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
cytB dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
dst4 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
gdcA dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
geneDDB0231382 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
geneDDB0231673 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
geneDDB0232098 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
geneDDB0233277 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
geneDDB0233987 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
guf1 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
lagC3 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
lst8 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
pakC dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
pppA dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
proS dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
rpb3 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
rpl12 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
rpl5 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
rps13 dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
snpA dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
tpsC dictyBase Home >> Chromosome 4:1777328..1781349 >> Gene: BC4V2_0_00680 >> Regulatory Region
Query for a group of genes. Learn about how the analysis was done.
Return to Home Supported by NIH (NIGMS and NHGRI) Send a Message to the dictyBase Curators