An Online Informatics Resource for Dictyostelium
  Search dictyBase:
use * as a wildcard character
Genome Browser BLAST dictyMart Stock Center Research Tools Help Links Contact Us

Detailed motif information

General information
Motif ID: mDDB0231480db012
Number of genes with the motif: 40
Motif logo

Sequence logos were rendered with the Delila Programs from Schneider Lab.
Nucleotide frequency table
position012345678
A100% 0% 9% 88% 28% 88% 28% 9% 9%
C 0% 40% 61% 2% 61% 2% 61% 22% 61%
G 0% 0% 2% 2% 2% 2% 2% 2% 22%
T 0% 60% 28% 9% 9% 9% 9% 68% 9%
consensusAYYAMAMTC

Matching with known binding sites

1. best match (score: 1.96)
with TRANSFAC motif: BPV1$BPV1_01 - BPV-1 (bovine papilloma virus-1)
bound by: E2
        GAACCACACCCGGTAC
          +|+++++|+
          ATCACACTC
           CT A ACG
2. best match (score: 1.43)
with TRANSFAC motif: AS$ATHB9_22 - artificial sequence.
bound by: ATHB-9
        GTAATGATTACACCC
              ++|++++|+
              ATCACACTC
               CT A ACG
3. best match (score: 1.40)
with TRANSFAC motif: DROME$EVE_20 - eve (even-skipped)
bound by: Gt
        GTGTTACCAAACTGCGACGATTGTTCAAGATGCTGCAATAAAGTC
             +|++|+++|
             ATCACACTC
              CT A ACG
4. best match (score: 1.23)
with TRANSFAC motif: DROME$ANTP_09 - Antp (Antennapedia)

        AACGCCAGTGAATCACAATGAGCC
                   ++++++|+|
                   ATCACACTC
                    CT A ACG
5. best match (score: 0.52)
with TRANSFAC motif: DROME$BTL_08
bound by: Cf1a
        TTAATTGATTAAAATGC
               ++|+|+|+|
               ATCACACTC
                CT A ACG
Gene expression of all the genes with the motif

Positional distribution of the motif in the regulatory regions of all relevant genes

Links to genes with the motif
Link to results pageLink to detailed gene info
BC4V2_0_00415 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BC4V2_0_00565 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BC4V2_0_01523 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BC5V2_0_01370 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BC5V2_0_01426 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BEC6V2_0_00188 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
BEC6V2_0_00605 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC1V2_0_00672 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC1V2_0_01318 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC2V2_0_01365 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC2V2_0_01922 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC2V2_0_02503 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC2V2_0_03148 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC3V2_0_00272 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC3V2_0_00480 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC3V2_0_01433 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
JC3V2_0_02011 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
alrE dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
dstA dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
expl3 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
gdt9 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
gefQ dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
geneDDB0216387 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
geneDDB0230050 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
geneDDB0231625 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
geneDDB0234027 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
geneDDB0235286 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
hmgL dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
manD dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
mhcA dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
phdA dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
pks29 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
prsA dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
repB dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
rngB dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
rpl24 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
rpl26 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
rpl9 dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
rsmD dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
trpS dictyBase Home >> Chromosome 4:1046736..1047381 >> Gene: BC4V2_0_00415 >> Regulatory Region
Query for a group of genes. Learn about how the analysis was done.
Return to Home Supported by NIH (NIGMS and NHGRI) Send a Message to the dictyBase Curators